Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14515H11
Clone ID IST14515H11
Vector VICTR74
Project tigm

Sequence tag IST14515H11HMF1
Sequence
GTATAGGTGTATCCATATAAACACATGAGTCTCTTTTGTTTTTACTTTTTATCCCTGGGAGGGGCGAGTATCAAATGCAC
ATCTGTTTGAGGAACTCACTCAGGAAAAGCCAAACTGCAAACAAAATAATTTCCTTGGAATGGGGCTGACACCCATCTCC
AAATACTCCTCAACAATTTGGTATGAACTCCATCTTCTGGTACACGGAATTACTTTTTCTTCCAAGTCTCCCAATTATTG
TATTTCAAGTCAAATGTCTCTAGACTACTCACCTCCGAGTTATCTAAATTCATGTTTGCATTCGCTGATATTAGGGACCT
CAGGCACTGCTGATTTTGTCACCATCTCATACAGTCTGCGGACACGGTTTAGAAAAATTTAACCTACACCATCNTGCTCC
AAACCCAACACAATCTATCANGTACTGACTGCATTCTGCATATANTCNAGANATTNNTTANTGAGCTGCGGGAANCTTTT
CATACNGNNNGAANCCTTANTTCACAATANATNCANTGCNCCAAAATCANANANCCNANGAANACATCCGGNTANNTTTT
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14515H11HMR1
Sequence
ATACCATACAGACTTTAACAGAGAGATTTTTTTTTTAATTGTCACTGACAACTGCTCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI16684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135085134..135085194 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028165 (Cisd2) NM_025902 CDGSH iron sulfur domain 2 Gene [Source:MGI (curated);Acc:Cisd2-001]

 
Come back to gene ENSMUSG00000028165


For any suggestions or comments, please send an email to unitrap@crg.es