Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13311A11
Clone ID IST13311A11
Vector VICTR74
Project tigm

Sequence tag IST13311A11HMF1
Sequence
TAACAAGATCTGACACCCTCTTCTGGAGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAAATAAATAAATCTTTA
AAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI4479 UNI9446 UNI36429 UNI36430

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 183805625..183805713 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 19834572..19834660 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045671 (Spred2) NM_033523 sprouty-related, EVH1 domain containing 2 Gene [Source:MGI (curated);Acc:Spred2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 103101686..103101774 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021188 (Trip11) thyroid hormone receptor interactor 11 Gene [Source:MGI Symbol;Acc:MGI:1924393]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 57263268..57263356 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054509 (Parp4) poly (ADP-ribose) polymerase family, member 4 Gene [Source:MGI Symbol;Acc:MGI:2685589]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 97357255..97357343 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31572202..31572290 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 59254025..59254113 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 45989469..45989557 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 144196287..144196375 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 151893896..151893984 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028034 (Fubp1) NP_476513 far upstream element (FUSE) binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1196294]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 107447388..107447476 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42930010..42930098 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 147973284..147973372 89
NO GENE  

 
Come back to gene ENSMUSG00000028034


For any suggestions or comments, please send an email to unitrap@crg.es