Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14578B11
Clone ID IST14578B11
Vector VICTR74
Project tigm

Sequence tag IST14578B11BBF1
Sequence
GGCTATAGCTCTTCCCAGCCTGGGTTGTGGAGAGAAGTTTCCCTGCCCCAGACAGCAGGAAGGCTGGTGCGCAAGGACGG
TGGGCGGAGATAACCGAAGATACTGTACTAGTGCTACTGTGCTTTGAAATCCCTGGCTATGGAAGACAGGAACAGTCCTC
CAGGAGAGCAGGAGGGAGAGATGAGTTCCCTCAGAGAAGCCCAAGACCTGGCCATGAGTAAAGCCCTCACCTTGCCCATC
AGGAAGGTAGTTGTACCAAAAGACTGCAGTTCCTTGCTGGGGCTTGACACGAAGGTTGCCCTTGTCACAGTGCCTTCGAG
TGTCCCGGANATCGACATCATCCTGAATCAGACTCTGTAGGCAACAAGGTGAGGCTGTTTGTGGACTGCCTGCCNTTGCA
GGACCANGCAGCCANNGTTGGCTGGAGGGAAAACAGGCNNATGTGCCCTCGTCCCANCTCTGGAANGGTGTGTNCNCACT
TGCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108481817..108482301 463
 
EST/CDNA Est Name
  BF783486.1 - CJ224426.1 - BY573247.1 - BB733447.1 - W53802.1 - BB332965.2 - BB770824.1 - BE863811.1 - BX521926.1 - AA004130.1 - AA386880.1 - BB584347.1 - AA387084.1 - CF533944.1 - AA386709.1


Sequence tag IST14578B11HMF1
Sequence
GGCTATAGCTCTTCCCAGCCTGGGTTGTGGAGAGAAGTTTCCCTGCCCCAGACAGCAGGAAGGCTGGTGCGCAAGGACGG
TGGGCGGAGATAACCGAAGATACTGTACTAGTGCTACTGTGCTTTGAAATCCCTGGCTATGGAAGACAGGAACAGTCCTC
CAGGAGAGCAGGAGGGAGAGATGAGTTCCCTCAGAGAAGCCCAAGACCTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108481817..108482030 214
 
EST/CDNA Est Name
  BB584347.1 - AA386709.1


Sequence tag IST14578B11HMR1
Sequence
TANCNNNCTCAGAAGCAAGGAAGCTTGGTTAATTTTAAGGGCCAGTATGTTC
Sequence Type genomic DNA
Unitrap ID UNI26390

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108481770..108481813 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006675 (4933406E20Rik) NM_028944 RIKEN cDNA 4933406E20 gene Gene [Source:MGI Symbol;Acc:MGI:1921693]

 
Come back to gene ENSMUSG00000006675


For any suggestions or comments, please send an email to unitrap@crg.es