Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14742E10
Clone ID IST14742E10
Vector VICTR76
Project tigm

Sequence tag IST14742E10HMF1
Sequence
CTCCCAAAGGTAGAGAGTCACACAGCATCCTTGGGCAGCTTTACTGAGCACCCAAGAAGCAGCAAACATGTGCTCAAGAA
AGCACAAGGTGAGGCCCTAACTCCATCAACAGCTGGGAACCTTATCAACTCTAAACCCACCCAGAGGTGAGCGGCCTGGG
GCTGGAGTGGCACCCTANAGTCTTGCTATGCAGCCCATACTGGCTTTGCACTCACTGTGTAACTCAGCAGGCCTTGAACT
CTTGATCTTTCCAGCTTANCCTACCAAATGCTAGGATAACAGGCATGCGTANCTTCACCCCGTGGTCTTGAATGCACCAC
CCAGANAAAGACACTTGGCTTCTGTTCTCTCCGGCTTGGGATCTGCTGAATGGCAGTCANGGGACACNNCAGGATATGGG
AAGGGCTGGCCCTTCTAGGGTGACTGANCANAGGTGCATTGNAAGTCTGCCANCANGCTGTGCNNCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104153809..104154271 439
NO GENE  


Sequence tag IST14742E10BBF1
Sequence
CTCCCAAAGGTAGAGAGTCACACAGCATCCTTGGGCAGCTTTACTGAGCACCCAAGAAGCAGCAAACATGTGCTCAAGAA
AGCACAAGGTGAGGCCCTAACTCCATCAACAGCTGGGAACCTTATCAACTCTAAACCCACCCAGAGGTGAGCGGCCTGGG
GCTGGAGTGGCACCCTAGAGTCTTGCTATGCAGCCCATACTGGCTTTGCACTCACTGTGTAACTCAGCAGGCCTTGAACT
CTTGATCTTTCCAGCTTANCCTACCAAATGCTAGGATAACAGGCATGCGTANCTTCACCCCGTGGTCTTGAATGCACCAC
CCANNNAAAGACACTTGGCTTCTGTTCTCTCCGGCTTGGGANCTGCTGAATGGCAGTCANGGGACACAACAGGATATGGG
AAGGGCTGGCNCTTCNAGGGTGACNGAGCNNANGTGCANTGTANGTCTGCCAGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104153818..104154271 424
NO GENE  


Sequence tag IST14742E10HMR1
Sequence
GGAGGCCTGTCTCCCTAGAGAGCAGGGAACCTTGTGCCTCCCTGGGAACATTCAAAGCCAGTAGAGATACCAACTCCTGC
AGTGCCTTCTGCCCTGCCCCTTGAGATTTATGATTTCCTCATGCCCCTTGCTGAGCTCANACATGATACCATCCCCCATC
CCCCCCCACATCAGGGGCAGGATATCACACTACTGCACTAGCATGGGAAGATGGATANACTCTCTTANCACCAGGGCGGT
CACTGGTGGAGTCCGGGAATGCCTCTATCTCTACTAAGGACTCCGTGACTGCTTCGTTGGGTTTGCTGTCCCTCTGANTC
TGTCTTCCATTTCCTTAATCTTACTCCGACCANATCCATTGTTGGACTTTGCCTTCCANGCAGTTC
Sequence Type genomic DNA
Unitrap ID UNI27131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104154268..104154652 373
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es