Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14466E4
Clone ID IST14466E4
Vector VICTR74
Project tigm

Sequence tag IST14466E4HMF1
Sequence
AAGCTTTATAGTAGCATTTTTCCAATCAGAACCCAAACAAGTGCGGAGGCGCCTCCGGGATGAAGGACTGGCTTAGCAGC
AGCGAATGAATGCCTAAGTGCAGAAAGAACCAAGATCCCTGTGACAGGGTCACTGCCCTAAACAACCTCTGCAACCCCTC
AGANCTATAGCAAGACTCTGAGCAACTACTTCTACCTGTGGTGGCAATCACAGAATGCCTCAGANAGGAGGTGACCCTGG
AACAGAGTTTAAAAATGAGTAAGCCTGGCTTGGGGGCTGGGGGACAACTGTCTCCCTANCACTCTTGGGCAGAGGCAGAN
GCANACAGCCTACCAGAGACCCCATGCNAGCTCCAGCTACACAGGGTANCCCTGTCTNANNTNATTATCNTCCTAANNTT
TN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 119017274..119017674 373
NO GENE  


Sequence tag IST14466E4HMR1
Sequence
TTTGAGCTGGCCGCCCCGGCTCATGCCTTTCTTTAATTCTACCCCTCAGGAGGGAGAGGGGGGCGGATCTCCATGAGCTT
GAGGCCAGCCTGGTCTACATGGAGTTCCAGGAT
Sequence Type genomic DNA
Unitrap ID UNI8731

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 119017673..119017785 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018076 (Med13l) NP_766012 mediator complex subunit 13-like Gene [Source:MGI Symbol;Acc:MGI:2670178]

 
Come back to gene ENSMUSG00000018076


For any suggestions or comments, please send an email to unitrap@crg.es