Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14912G7
Clone ID IST14912G7
Vector VICTR76
Project tigm

Sequence tag IST14912G7HMR1
Sequence
TCAGATGCACCANAAGAGGGTGCCTCATTACAGATGGTTGTGAGCCACCATGTGGTTGCTGANATTTGAACTAAGGACCT
TCANAAGAGCAGTCAGTGCTCTTAACCGCTGAGCCATCTCTCCAACCCCNNCNNNNNTNCNNGTNNNGGNTNNNNNNTTC
TTGGGTCANGTGTCCACTGTGGACAGGTGGCCTTTANAGATATTCCTGCCTCCTCACTGATCTGTGAGGTCCTCCGTGGT
ANGATAACCCTTCTCCATCTAATGTCTCTGGCTGGGCCCAGGGCAAATTGGTCCCTGTANTTCCTGCTGAACCGATATGT
AGGAGCCTGCTGTCANCTGANGTCTGTCTAGGATANATAGAAAGCGGTGAGGCANGANGCTNNTTGGAGTAAAGTCTCTC
TTCTCCTTGCANGCCCCTANCTTCNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 152066808..152067231 241
NO GENE  


Sequence tag IST14912G7HMF2
Sequence
NGGACAGCTACAGTGTACTTACATATAATAAATTN
Sequence Type genomic DNA
Unitrap ID UNI36570

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 54690200..54690232 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32372230..32372262 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 103682144..103682176 33
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 133584513..133584545 33
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030727 (Rabep2) NP_085043 rabaptin, RAB GTPase binding effector protein 2 Gene [Source:MGI (curated);Acc:Rabep2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 59138162..59138194 33
NO GENE  


Sequence tag IST14912G7BBF1
Sequence
AAGACAGCTACAGTGTACTTAGATATAATAAAATCTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 152067231..152067268 38
NO GENE  

 
Come back to gene ENSMUSG00000030727


For any suggestions or comments, please send an email to unitrap@crg.es