Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14844B4
Clone ID IST14844B4
Vector VICTR76
Project tigm

Sequence tag IST14844B4HMR1
Sequence
ANGGCCNGNTNANCNNCCNNTGANNNNANANCNGTCNATCNNNNTGTTCNNACGCNNACTGCTTTTCAAAAGCNNAATCN
CACCGTCCACTACCCTTAACTGACTCTTACGGGGTCTTTTCAACATGCTGTTTACCCATCAGCTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14844B4HMF1
Sequence
TACAAAGTAAGATGTGGTCCAGCAGTATGCAACTGCTGCAATTACACACACACACACACACACACACACACACACACACA
CACACACACNCN
Sequence Type genomic DNA
Unitrap ID UNI36572

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 99073570..99073658 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071224 (AC121839.3-202)  

 
Come back to gene ENSMUSG00000071224


For any suggestions or comments, please send an email to unitrap@crg.es