Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14676D6
Clone ID IST14676D6
Vector VICTR74
Project tigm

Sequence tag IST14676D6HMR1
Sequence
NANCTCATTACGGGTGGTTGTGAGCCNCCGTGTGGTTGCTGGGATTTGAACTTCGGACCTTCGGAAGANCAGTCGGGTGC
TCTTACCCACTGANCCNTCTCACCANCCCTCCCCCTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14676D6HMF1
Sequence
ATCTGATGTCCTCTTCTGGTGTGTCTGAANACAGCTACAGTGTACTTACATATAATAAATAAATAAATCTTTAAAAAAAA
AAT
Sequence Type genomic DNA
Unitrap ID UNI4421 UNI11991 UNI30988 UNI34525 UNI34526 UNI34527

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 133876508..133876589 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 23711363..23711444 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 51091221..51091302 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020385 (Clk4) NM_007714 CDC like kinase 4 Gene [Source:MGI (curated);Acc:Clk4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 117844578..117844659 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056553 (Ptprn2) NM_011215 protein tyrosine phosphatase, receptor type, N polypeptide 2 Gene [Source:MGI Symbol;Acc:MGI:107418]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12362552..12362633 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 27495127..27495208 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022265 (Ank) NM_020332 progressive ankylosis Gene [Source:MGI (curated);Acc:Ank-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13810071..13810152 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022682 (Rrn3) NM_001039521 RRN3 RNA polymerase I transcription factor homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1925255]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35553729..35553810 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 9979606..9979687 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024287 (Thoc1) NM_153552 THO complex 1 Gene [Source:MGI Symbol;Acc:MGI:1919668]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121761870..121761951 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 83636613..83636694 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 114584005..114584086 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108557859..108557940 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 91091448..91091529 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 29612059..29612140 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053898 (Ech1) NM_016772 enoyl coenzyme A hydratase 1, peroxisomal Gene [Source:MGI (curated);Acc:Ech1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73151510..73151591 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 35135913..35135994 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 101167288..101167369 78
NO GENE  

 
Come back to gene ENSMUSG00000053898


For any suggestions or comments, please send an email to unitrap@crg.es