Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15049E1
Clone ID IST15049E1
Vector VICTR80
Project tigm

Sequence tag IST15049E1HMF1
Sequence
GGCTTCATCAATAGGTTCTCTTCACAATACCAAGCCTCAACTCTTTTGCATGGTCCTTTCAGTCCTGGGTCTTCAAATGT
CACTAAGGCTGTACCTTCAACGATGGCCTCTCCTAGCCTCTCACAGTGCCTAACCTCAGCTGCTCTCCATGACCCCTTCA
TAACTTCAAAATCAGTCCACCTGGGTATCTCTTACACACTACCAATTCCAGCTGAAACATGAGCTACAACCTTGGCTATT
AATGGAACACAGGCTCCTTTGTGCTCTCTGAAAACACTTCCCAGATTTCACTTCAATGATGCTGGTCTCTTCTTAATCAC
CGTGAACTTCCTAGCTCTAGCTAACCAGCATCAATTGTCCCAGTAGTCTTGTCCCTTCTATTGACNNAAACCAGANCCAC
ATACATGGCCTAAGCTGNCNANNNAGTTCTGCTGCTTACTANAGCTGAAGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108506610..108507060 433
 
EST/CDNA Est Name
  CF895920.1


Sequence tag IST15049E1BBF1
Sequence
GGCTTCATCAATAGGTTCTCTTCACAATACCAAGCCTCAACTCTTTTGCATGGTCCTTTCAGTCCTGGGTCTTCAAATGT
CACTAAGGCTGTACCTTCAACGATGGCCTCTCCTAGCCTCTCACAGTGCCTAACCTCAGCTGCTCTCCATGACCCCTTCA
TAACTTCAAAATCAGTCCACCTGGGTATCTCTTACACACTACCAATTCCAGCTGAAACATGAGCTACAACCTTGGCTATT
AATGGAACACAGGCTCCTTTGTGCTCTCTGAAAACACTTCCCAGATTTCACTTCAATGATGCTGGTCTCTTCTTAATCNC
CGTGAACTTCCTAGCTCTAGCTAACCAGCATCAATTGTCCCAGTAGTCTTGTCCCTTCTATTGACNAAAACCAGANCCNC
ATACATGGCCTAAGCTGNCAANCNAGTTCTGCTGCTTACTANANCTGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108506613..108507060 430
 
EST/CDNA Est Name
  CF895920.1


Sequence tag IST15049E1HMR1
Sequence
AGCCTAGTTGCAACGGAAGANACTTGTGTATTGGAGATACCAGTACCATCACCATGATCACCAAGAACAGCAGCAGCTGT
GGAGTGAAGTCAGCCATAGCCTACCTAGCATGCTACAAAGATCATGTATGAATCCCAGACATTGGAACAAGAAGCTGTGA
AGTTGAAGTTACATTGGAGACCCCAAGATGTTCGAGATGCCAAAGCCATAGGATATCTGCTGAGAAAAACTGTTC
Sequence Type genomic DNA
Unitrap ID UNI14993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108507057..108507290 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es