Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14732E8
Clone ID IST14732E8
Vector VICTR76
Project tigm

Sequence tag IST14732E8HMR1
Sequence
AGATGGCTCAGAACTGACTGTTCTTCCNAAGGTCCTGAGTTCAAATCCTACAACCACATGGTTGCTCACAACCATCCGTA
AAGAGACCTGACGCCCTCTTCTGATGCGTCTGAAGACAGCTACAGTGTACTTAGATATAATAATAAATAAATCTGTAGGT
CAGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 107003358..107003523 164
NO GENE  


Sequence tag IST14732E8HMF1
Sequence
TTNAANNNCACTATATTATTAGTGGTATGACTTCAAGCACCGCGTACTTTTTGATTGTTTCCTTTAGATTGGGTCTTTTA
CTGCTCTGGAACAGAAGGCAAGTGTAACTGCCAGTAATCCCAAGAAATCTGCCTGTCTCAGCCTCCTCAGTGCTGGCGTT
ACAGGGAGCGTTCGTTATTACACCTATTTTAAGACGCTTGAATTCTGGGATTGAACTCTTTCCTTCTCCTAAACAAGTAC
TTTACTAACTTACATTTACCTTTTCTAAAAAACAATTCAGTTTTTGTTATTTGTTTGTTTGTTTGTTTGTTTTTTGTTTT
TGGTAAGTATTCTTTGGTGTTACCACTCTAGTTGATGGCATTATCCTAGGANAGTGGAGCCTGAAAATGAGGCNCACTAA
AGTCTCATGTACTANTCAACG
Sequence Type genomic DNA
Unitrap ID UNI20018

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 30684477..30684888 406
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040850 (Psme4) NM_134013 proteasome (prosome, macropain) activator subunit 4 Gene [Source:MGI (curated);Acc:Psme4-001]

 
Come back to gene ENSMUSG00000040850


For any suggestions or comments, please send an email to unitrap@crg.es