Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12819C2
Clone ID IST12819C2
Vector VICTR76
Project tigm

Sequence tag IST12819C2BBF1
Sequence
NTGGTATCGCTCCATCACTGGCCTTATGATATTAGCATAGGATTATTTTATAAAAGCCTCCTTCCCCTGCTTGACCTGAA
TTAAACATGTGAAAGGGGGAGCCTTGGAAAGATACATTTTAATGTTCACAGCAAACAGTTTCCANACCANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 137654164..137654316 147
NO GENE  


Sequence tag IST12819C2HMR1
Sequence
CNNCCATCTGCCTCACTAGACCCTCCAGTAAGGATGTAGTGAGTACGTGCTAACANAGCCTGCCTTTAAAAGAAAATTAA
GGGTCATTGTAAAATGTTGTGAGTTTTTAAATTGAAGTGTTTTATTCAAATGCTTTGACAACCCGTCTGCTCAAATGC
Sequence Type genomic DNA
Unitrap ID UNI27379

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 137654010..137654163 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030850 (Ate1) NM_001029895 arginyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1333870]

 
Come back to gene ENSMUSG00000030850


For any suggestions or comments, please send an email to unitrap@crg.es