Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12141D4
Clone ID IST12141D4
Vector VICTR76
Project tigm

Sequence tag IST12141D4BBF1
Sequence
NGANAACCTGCTGACCCCNCNATGGCANCTAACGCCCCGCTATGTGGCCAANCANTTCNGACGANNTGGCGCCATCTCCG
GGGTGCCCCCGGCCTCCCTGTGGCCCACCCCAGAGCAGCTGCGCGAGTTGGAGGCCGAGGAGCAAGAATGGTACCCGAGC
TTANCGACCATGCAAGAGTCGCTGCGCTTGCAGCAGCAGGCCTTGGAGGCAAGGCGCCAAGCCAGGTGGGTGTGATGGGG
CACGTACCCCAGGGCCCCGAAACCAGGAATCATCCGTAGTAGGCACGCGGATCCCTTGTGGCGTGGGCTNAAACATTACA
TGTNNACTTTGCTGCAAAGCAGACATCCTTGTAGTCATTCAACTGCANTTTTTGGTTTTTTGTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI10600

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87356316..87356704 361
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033751 (Gadd45gip1) NM_183358 growth arrest and DNA-damage-inducible, gamma interacting protein 1 Gene [Source:MGI (curated);Acc:Gadd45gip1-001]

 
Come back to gene ENSMUSG00000033751


For any suggestions or comments, please send an email to unitrap@crg.es