Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14995B5
Clone ID IST14995B5
Vector VICTR78
Project tigm

Sequence tag IST14995B5HMR1
Sequence
CGACAAGCCTCCGCCGGGCCNGATTCCTCTGGGCTCCCGCGAGAGAGGCGGGAGAAGGACACNNCGTGGGCACGCGCTTT
GGGGGGCCGGGCTCCGAGGCTTGGGGGGCCCCGGATAGTTGATCTCGGAGGCCCGGTGATCCGGGGGTGGAAN
Sequence Type genomic DNA
Unitrap ID UNI29909

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 4324545..4324696 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040028 (Elavl1) NM_010485 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 1 (Hu antigen R) Gene [Source:MGI Symbol;Acc:MGI:1100851]

 
Come back to gene ENSMUSG00000040028


For any suggestions or comments, please send an email to unitrap@crg.es