Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12046C2
Clone ID IST12046C2
Vector VICTR76
Project tigm

Sequence tag IST12046C2BBF1
Sequence
NTGGTACACATATATATGTTNNNGCNAANCATCCATCCANCTGANATAACTCTGAAAGAAAAAGAAAAAAGAAAGGTTTA
NGTGGCATGCACCTATTGTCTCTGCACTTGGGAGGTGAAGGCGAGAGTTCAGGGGTCAAGGGTTCAGGGGTCAAGGGCGG
CTTTAGTTACAGAACAAGTTCNNGGTGANCCTGACCTATGAAANACTATANNANAAGACAATTTAAAAATTTTTAAATTT
AATTTTCTTTTATGTCATTTGGTGTTTTGCCTGCCTGCATGCCTGTGTACCACATGNACACAAGGTGCCTGCANAGTCTG
GAAGANGGCATTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12046C2HMF2
Sequence
GAGGCACTCAGTTATCCCTAGGTAATTCAGTGAATTGGTGGAAAGGGAAGGATTTGAACTCTGTCTCTTGACGCCTTGAG
TCAACG
Sequence Type genomic DNA
Unitrap ID UNI10567

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87332738..87332822 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030539 (Sema4b) NM_013659 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B Gene [Source:MGI (curated);Acc:Sema4b-001]

 
Come back to gene ENSMUSG00000030539


For any suggestions or comments, please send an email to unitrap@crg.es