Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10098H1
Clone ID IST10098H1
Vector VICTR76
Project tigm

Sequence tag IST10098H1HMF1
Sequence
GGCCTAGGCGGAGCCGAGTGTGGATGANGCTTGCGGCCCTGTCTCTGGTTCTGTGGTCATGGCAAGCCTACCATGTGGTC
CTCTAAAATGGTTTATCCANATACTCAAAACAGAAGCCGGGACCTGGCTCAGGTGGCAGTGCCTGACTGCATGTANAAAG
CCCTGGTTTCCTCTCCAGCACCACAAATACCAGGCATGGTGGCATCCACCTGTAATCCCANCACTCANGANGTANTGACA
GGTCATTTATGGTTACATATGGCAGCCCAGGCCNNTCTGGGAGGCCATTCTAANAAAAAAGCAAAGGTACTTGCCACCAA
NCTTGGTGGCCTGANTGCTATCCTTGGTCCCCACAANCTCTCCTTGACTCTCGGTCCTCTATATGTACACACAAGCACAT
AATCAATCAATAAAATGAAACCTGTAAAACAAGCCAGGTCCANGGCTTGTACCTCTTTANTCCTACACTTGGGANGTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 13190615..13191092 444
 
EST/CDNA Est Name
  AI036168.1 - CF198064.1 - BG080074.2 - BF786829.1 - CF104155.1 - BQ256776.1 - BU938672.1 - BY707909.1 - BU583840.1 - BB642388.1 - BF118651.1 - BU583797.1 - BF318919.1 - AW744229.1 - CF622620.1 - BF013052.1 - BE303556.1 - BY083371.1 - BY089334.1


Sequence tag IST10098H1BBR1
Sequence
GGCCGTAGAAAGACAATGCCAGGGTCAAGGATGGATTCACCATGTAGGGTGGACACCGCCTTGCCCTCTAGTCTGCAGTT
GCATGCCACCGTGACCTTTCTGCATCATCGAATGTTTATAGTTCCAGGAGAGATGTTTTGGGTCTGGGAGGTTATGGAAG
GTGAAGGGCTACAAAGGGCAGGAAGAGGCGGGGCAGGGAAGGCTTGGCACAAAACCCGGTAGTGTGAGTTTACTTAATTC
TTGCTATTGGTTTATCTCTGAAGGGAATCTTGGCCCATTCTCCTTCCTATGTTCTGGGCAGTTTCTGTTTCAGTTCTCTT
GGAACTTTGGTGCATGCTGTAGCCCAGGCTAGCCCTGAACTCAGCAGTCATCCCACCTTAGCCTTGAGAGTGTTAACAGT
TACAGGTGTGAGCCACCAAGCCTAGTGTTTGGTTGTTTGTTGAGACCGAGTTTCATTATGTAGCCCTGGCTGGCCTGTTA
TGTAGACCAGGTTGGCCTTGGACTCAGAAATCTGCCTGCCTCTCTTTCTAGAGTACTGGGATTAAGGATCAGAGGGGG
Sequence Type genomic DNA
Unitrap ID UNI27089

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 13190062..13190618 557
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038515 (Grtp1) NM_025768 GH regulated TBC protein 1 Gene [Source:MGI Symbol;Acc:MGI:1914040]

 
Come back to gene ENSMUSG00000038515


For any suggestions or comments, please send an email to unitrap@crg.es