Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12831A4
Clone ID IST12831A4
Vector VICTR76
Project tigm

Sequence tag IST12831A4BBF1
Sequence
GTCCCCAGCACCGAAACAACCCAAACCTTGTATCTTCTGAACCACTCCCTCTCAAGTAGGGGTTACAGGCTGGCCCTAGT
CCATTCTGTGTCTCCTGGAGGCCANAGGCAGTCAGGGCTATGGGCAGAGTGCANATCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75110111..75110247 133
NO GENE  


Sequence tag IST12831A4HMF1
Sequence
NTCCCCAGCACCGAAACAACCCAAACNNNGTATCTTCTGAACCACTCCCTCTCNNNNNNGGGNNANAGGCTGGCCCTAGT
CNANNNNGTGTCTCCTGGAGGCCAGAGGCAGTCANGGCTATGGGCAGAGTGCAGATCTGGAACCTGGCAGCCGCCTGGGA
GCTGCAGGAGCTGGGAGCAGCCTANCTGTCCTGGCATGGCTCCACATTCTTTCANCCTCATCTCTTTAAAAGGAGTGGGA
GCTTATCCAGGGCCTGCCTGGTCTTTGTGAGCTGGCGCCATGTCCTTCCCTCTTGAGTGGTCTGTGGGANACCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12831A4HMR1
Sequence
GGGACCTTTCGGAATTCCTGTGAAATCTCANAAGAGCCACTAGAGTCCACCGATGCTCCTGTGTTGTGCCTAGCTACAAA
TACAAACCTAGCATTCCAAGGGCTGCAACAGCGGTGAGACTGAGACCCTGACAGTCC
Sequence Type genomic DNA
Unitrap ID UNI16343

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75109980..75110115 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020196 (Cabin1) NM_172549 calcineurin binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1298375]

 
Come back to gene ENSMUSG00000020196


For any suggestions or comments, please send an email to unitrap@crg.es