Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14849D3
Clone ID IST14849D3
Vector VICTR76
Project tigm

Sequence tag IST14849D3HMF1
Sequence
CCAGTCTGATTATACACATGCTAAGTGACAGAAAGGGTCTGGAATAAATACATTTAAAAAAAGAGGAAAAGCTCTGAACT
AANTGGCATGCAGTAGGTCCTATGGGGGAGGGGAAGTGACNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3156469..3156588 118
NO GENE  


Sequence tag IST14849D3BBF1
Sequence
CNANTCTGATTATACACATGCTAAGTGACAGAAAGGGTCTGGAATAAATACATTTAAAAAAAGAGGAAAAGCTCTGAACT
AAGTGGCATGCAGTAGGTCCTATGGGGGAGGGGAAGTGACTGAGAAACTAAGTGGCACGCAGTAGGTCCTATTGGGTGTG
TGTGTCTGAGACAGGAAGTGAGCAAGCAAACACAAGAGGCGTGTCANCAGCCGCAGCTCTTCANTCATCTTTGTCTTTTG
CTCCGTGCTTCANGATACNTGTGAACTCANCGTAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3156315..3156584 260
 
EST/CDNA Est Name
  CV304002.1 - AI851409.1


Sequence tag IST14849D3HMR1
Sequence
CTGGAACGGAGGGCAATGTTGTAAATTGTACTGAAAACGAGATGCAAATAAAAAATGAACCACTCTGAAAGCCCAGGACA
ATATATCAGGGGTGGGGGTGGGGGGTGGAACAAAAAAAAAC
Sequence Type genomic DNA
Unitrap ID UNI14525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3156585..3156704 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046201 (Rbm16) RNA binding motif protein 16 Gene [Source:MGI Symbol;Acc:MGI:1925212]

 
Come back to gene ENSMUSG00000046201


For any suggestions or comments, please send an email to unitrap@crg.es