Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12740A9
Clone ID IST12740A9
Vector VICTR76
Project tigm

Sequence tag IST12740A9BBF1
Sequence
CCACTGTGCCCACCTCCCAGAGCTTCCTTGGTGCCGACTGAGCCCTTCTCCCCACCCCCCCCAGCCCTCTACTTCTCTGT
GTTTCCTACTCANAACAGCTTTCTCANAAATGCCANCCCTGCANCTTGTGAAACATCCTCTCCACTGCCTGGCATCTCAN
TGGAGCTTGCNNTNCNNACATNCNNGGNACTCNTNNNTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12740A9HMF1
Sequence
CAACACACACTGTAACTTCTTAGCAAGCTAAAGTCAGGCTAGGAGAACCTTCACTACCTGAGGCCCAAATTCCCATCTCT
GCCTCAGCTGCCAAGTCCAAGTCTATGGCATCTCAGCATAAAGAGCCTTAAAATCTTGCCAATTTGTACTGAGTGCTTTG
ATGGTGGGATTGGANATTAATAAAGAGATTGGACATGGGCTANTGCTGCATCCATTANTTCCAATACAGGAAAAAAAATG
TTACTTTCGGTTTTTGGTGTTTNTTTNAACGTGTGTGTGTGTGNNTNTNTGTNTNTNTN
Sequence Type genomic DNA
Unitrap ID UNI16328

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20505118..20505409 274
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es