Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12502G11
Clone ID IST12502G11
Vector VICTR76
Project tigm

Sequence tag IST12502G11HMF1
Sequence
TCTTNNNNNNNCANNNNNNAAGCTTTTTGGTGGCATTGTTTTATATATATATTATGCATCATATATGTATAATTATATGA
GTAATTATATAATATACAAAATATACATAACTAATGTCACTTTCCAGCAGGGGTAACTTAACCCCTCATTTTCTGTTTGC
ATGCCTTTCTTTTGTGTTTCCTCTNACTGANACTTTTGGANACAGGATCTTACTATGTANCCCTGGCTGTCCTGAAACTC
ACTATGTCAAGCAANCNNCTTCAACTCANANNNAN
Sequence Type genomic DNA
Unitrap ID UNI2675

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 112337002..112337250 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003604 (Aven) NM_028844 apoptosis, caspase activation inhibitor Gene [Source:MGI (curated);Acc:Aven-001]


Sequence tag IST12502G11BBF1
Sequence
TCTTAATTTATNAGTTTTAAAGCTTTTTGGTGGCATTGTTTTATATATATATTATGCATCATATATGTATAATTATATGA
GTAATTATATAATATACAAAATATACATAACTAATGTCACTTTCCAGCAGGGGTAACTTAACCCCTCATTTTCTGTTTGC
ATGCCTTTCTTTTGTGTTTCCTCTCACTGAGACTTTTGGAGACAGGATCTTACTATGTAGCCCTGGCTGTCCTGAAACTC
ACTATGTCAAGCAAGCCGCTTCAACTCAGAGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI2675

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 112336983..112337259 275
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003604 (Aven) NM_028844 apoptosis, caspase activation inhibitor Gene [Source:MGI (curated);Acc:Aven-001]

 
Come back to gene ENSMUSG00000003604


For any suggestions or comments, please send an email to unitrap@crg.es