Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10985A2
Clone ID IST10985A2
Vector VICTR76
Project tigm

Sequence tag IST10985A2HMF1
Sequence
CTCTCAGGCCNGGCAGACCCCCGTGCTCTCACCAGGAAGGTGGCCGGCTGTCTGGANCTAAAGATGGCGCCGCCCANAAN
CTCTGCGACTCTCTCGCCCGTCCCANAAACGGCTGGCACTCTGTATTCCNCACGGTCACCCGTGCNNCCTGNCCTCCGCG
GNNTCCCGGANCCNANAANGCTNCCGCCGGCGCCTGTGCCNCANACNTNTCAGGCCNNGCANACCCCN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10985A2HMR1
Sequence
AGAGGTTTGTGGCACAGGCGCCGGCGGGAGCCTTCTTGGCTCCGGGACTCCGCGGAGGGCAGGCTGCACGGGTGACCGTG
TGGAATACAGAGTGCCAGCCGTTTCTGGGACGGGCGAGAGAGTCNCAGAGCTTCTGGGCGGCGCCNTCTTCANCTCCN
Sequence Type genomic DNA
Unitrap ID UNI11782 UNI34848 UNI36584

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 47686055..47686211 151
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 57159092..57159248 151
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 37212824..37212980 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043153 (4930579E17Rik) NP_848744 RIKEN cDNA 4930579E17 gene Gene [Source:MGI Symbol;Acc:MGI:1923097]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71127706..71127862 151
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 27423992..27424148 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038127 (Ccdc50) NM_001025615 coiled-coil domain containing 50 Gene [Source:MGI (curated);Acc:Ccdc50-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 33171100..33171256 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038128 (Camk4) NM_009793 calcium/calmodulin-dependent protein kinase IV Gene [Source:MGI Symbol;Acc:MGI:88258]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 66928115..66928271 151
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 4818140..4818296 151
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 128116375..128116531 151
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 41880993..41881149 151
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 42072847..42073003 151
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 65844104..65844260 151
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 53921790..53921946 151
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 73083722..73083878 151
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 14977128..14977284 151
NO GENE  

 
Come back to gene ENSMUSG00000038128


For any suggestions or comments, please send an email to unitrap@crg.es