Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14856F4
Clone ID IST14856F4
Vector VICTR76
Project tigm

Sequence tag IST14856F4HMR1
Sequence
TCNCCNGCAGAATGGNCNNNNCCTGAGAGGAGAGACCTTGCCTATCTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14856F4BBF1
Sequence
GTTATTTACTGTACACAACTGACCAGATGACAGCATTAGTGAATGGCTAGTGTGACTAACATGACAAGGGTATCAGTGAT
CACAGTACCAACTAGTGTTTCCCAGCCAATAACATTTCCTGAAGTGGCAAATTTTATTATATCCTGGACACTTTAAAAAA
CAGAGATAATATAGGCCTCAAGCCTCATGCATAATAAGCAAATTCTTTATCACTGGACCATGCCCTANTCTGTTTGTTGG
ATTGTTTTTGTTTTTGAAACAGTCTTGCANAGTTGCTCCNGCTGTCCTTGACN
Sequence Type genomic DNA
Unitrap ID UNI12027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 29080555..29080846 286
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024780 (Cdc37l1) NM_025950 cell division cycle 37 homolog (S. cerevisiae)-like 1 Gene [Source:MGI Symbol;Acc:MGI:1914322]

 
Come back to gene ENSMUSG00000024780


For any suggestions or comments, please send an email to unitrap@crg.es