Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13244G12
Clone ID IST13244G12
Vector VICTR74
Project tigm

Sequence tag IST13244G12HMR1
Sequence
NACTCCCTANNNNNCTCAGCATGGTGAGAGCCTGTTACCATCTATCCCATCCAGGCTCTGGGCAAGAAGGGATGGCCAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13244G12BBF1
Sequence
GGAGTTACCACCAATCTTCCTAAATGCCNGCACCAGGTTTTCGGCCTCCCAACTAATAGATGCTCCATGGGCTCCGCATC
CATTCTAGGGCCTCCCTTCAAGTGTGCTTAACACTCCCATGGAACACACANCTTTCTCCAAGCCCTGGAGAGGTTCANGG
GCTTTNNNCTTTTGTNNGN
Sequence Type genomic DNA
Unitrap ID UNI30653

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4777684..4777858 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053550 (D430041B17Rik) NM_172737 RIKEN cDNA D430041B17 gene Gene [Source:MGI Symbol;Acc:MGI:3605641]

 
Come back to gene ENSMUSG00000053550


For any suggestions or comments, please send an email to unitrap@crg.es