Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10917D8
Clone ID IST10917D8
Vector VICTR76
Project tigm

Sequence tag IST10917D8HMR1
Sequence
TTANGAGATGAAAATAGGAAGATTANAAGATAAAGGACATTTTTGGCTCTATATCTGGTTGGAGGCCAGTATGAGACTAA
CGAGACTGTTAAAAAGTTGTTAAGGTTTAAGTCTGTAAAGGATTGGAAATTGGACTATACTGTTCACTGTGTTAGACATT
TGAGGACTTGTTATGACTCCAGTATTTGGTGGCCTTTCATCGCCAGACCTCTCTTAGTGAGTGGACTTGTCTTAGTGTGA
CAATGACACTATAGTCNTTATAGTCTTCCCAGTCTTANCNGCNTGTTGCCGGCGGGGGGGGGGGN
Sequence Type genomic DNA
Unitrap ID UNI29665

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 91457251..91457554 292
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035150 (Eif2s3x) NM_012010 eukaryotic translation initiation factor 2, subunit 3, structural gene X-linked Gene [Source:MGI (curated);Acc:Eif2s3x-001]

 
Come back to gene ENSMUSG00000035150


For any suggestions or comments, please send an email to unitrap@crg.es