Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12522E4
Clone ID IST12522E4
Vector VICTR76
Project tigm

Sequence tag IST12522E4HMF1
Sequence
AGAGAATGTGCATGTGTGTGTGCCACAATGAAATTGTGCAAATCTGAGGACAACTTGTTGGAGTCAGTTCAGTCCTTTTA
TCTTTATCATGTGGCCTGTGGGAATCAAACTCAGGTAGCAAGGCTTAGCAGCAAGCTACTTTACCCTCTGAGCAGGTCCA
GAATCTTTAATCTTTTTCAACTGGAGGGCAGTGGA
Sequence Type genomic DNA
Unitrap ID UNI5525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26062020..26062213 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005442 (Cic) NP_082158 capicua homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1918972]


Sequence tag IST12522E4BBF1
Sequence
AGAGAATGTGCANGNGNGTGTGCCACAATGAAATTGTGCAAATCTGAGGACAACTTGTTGGAGTCAGTTCAGTCCTTTTA
TCTTTATCATGTGGCCTGTGGGAATCAAACTCAGGTAGCAAGGCTTAGCAGCAAGCTACTTTACCCTCTGAGCAGGTCCA
GAATCTTTAATCTTTTTCAACTGGAGGGCAGTGGCCAAACACTAAGCCTCCTTCCCCTTTCCTTCTTTTTAAAATTATTA
GTGTGTGAGGGAAGCAGAAGACAGTTTTGTGGAGTCTGTTTTCTCCTTGCACATTTAGGTAGGTTCAAGAAATTTAATTT
TGGTCGTTTGTACAACAAATGCCTTTACCTGCTGAGCCACCCCCCACCCACCCACTTTCCCATATCTTAGAGTATAGGGA
GGTTGTCCANGCCTGGGGGCTCCTTCTTGGTCTTTTACAAATGAACTGTTTGTTATTGCCCCTGTAACCTGCTTANACAT
GTCCNCGGGTCTAGCTTGNACATCCNCCCACCNTACACCTGTTNCCCACTGGCAGNAANANNGGGCNANATGGGCANNNC
TNNGAA
Sequence Type genomic DNA
Unitrap ID UNI5525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26062020..26062576 521
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005442 (Cic) NP_082158 capicua homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1918972]

 
Come back to gene ENSMUSG00000005442


For any suggestions or comments, please send an email to unitrap@crg.es