Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST433164
Clone ID OST433164
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST433164
Sequence
AGAAGCCAGAGTACTTAGAGGGTCTCCCTGAGAAGATGAAGCTCTACTCTGAGTTTCTGGGCNAGCAGCCATGGNTTGCA
GGGAACAACGGTCACCTATGTGGATTNTATTGTTTATGANGGCCTTGATCAACACCGAATATTNNAGCCCNAGTGCCTGG
ATGCCTTCCCNAACCTGAAGGACTNNATGGNTNGCCTTTGAGGGCCTGAAGAAGATATCTGACTACATGAAGAGCANCCG
NTTCCTCTCCAAGCCAATCTTNGCAANGATGGCCTTTNNGAACCCAAANTNNGATTACAAAGCCCAGACCTGGGGGAANA
CTNANGAGTGCTCTGCTGGCCCTANCTNTNACCACGNGCAGCTTNCTTCTCCTTTCCATTCCCTATTCCTNCATTTACTC
TTCCCAGCCCTTCCCTCANCCAAGCCTCTGGGTCCTTGGGCTCTCCATTTCTTCATTAGTCTCCTCCTATCCCTTGTCTC
TGCCCTGCATCCAGCCCTTCCCTCAGTGATGGTTGGAGGAATGTACTAGACCCGAGAATAA
Sequence Type mRNA
Unitrap ID UNI17937

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 107784720..107787135 299
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040562 (Gstm2) NM_008183 glutathione S-transferase, mu 2 Gene [Source:MGI (curated);Acc:Gstm2-001]

 
Come back to gene ENSMUSG00000040562


For any suggestions or comments, please send an email to unitrap@crg.es