Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13055G7
Clone ID IST13055G7
Vector VICTR76
Project tigm

Sequence tag IST13055G7HMR1
Sequence
NGATNNTANNGTAAANGNCTGTNNNGGGGTAGTCTTAGACCCCTGTGAAAGAGTCATTCTTGAAACCCCTCTCCCCCAAG
GGGTCACAACCCACAGGTTGAGAACTGATGTGTTGGAGGATTGTTTTTGTTGTGCTGTTTTCTCCTGTTTTGTAAAACAG
GATTTTATTATAGTACTTGCTGGCCCCCAACTCAGTAATACGCCTGCTTTAGCCTCTCAAATGCTAGGATTATACACGTG
AGCTATCATGCTTGACTTTTTATTTTTCCTTTGTTTTGTTTTAAACTTCATCCTATTATAAATTATCTCAGGGGCATTAT
TTATGGAGTGTGTTTTAATGTTTCTAATATAAGTCCGGCTTATACATTAGATCTTATTAAATAGTCNTGTCTTTCATAAT
GAGGTTGAATAGTTAGTTCTGGGAATAAACGTGTTGATGTCNNTGTGCTTTGCTTGNGCTTTGCTTGCCTTCCATANATA
TACATTTCTTTCTGCNNNNNNTGCCTCTGCTATGGANTN
Sequence Type genomic DNA
Unitrap ID UNI15239

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102839333..102839847 475
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068823 (Csde1) NM_144901 cold shock domain containing E1, RNA binding Gene [Source:MGI Symbol;Acc:MGI:92356]

 
Come back to gene ENSMUSG00000068823


For any suggestions or comments, please send an email to unitrap@crg.es