Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15038A9
Clone ID IST15038A9
Vector VICTR78
Project tigm

Sequence tag IST15038A9BBF1
Sequence
CAGGTAGTTTGCGGGGAAAGAAGCTCAATAAATACACGCCTCAACAGAAGTACCGTAATTAGTGGGTGCCAGCGCTCCTA
GGTGATAAGTCCTTCATTCAGACAGCTGTAGGAATTGGGTATTAAACATTCTAAGTTCTTTGGGGAATTTATCAATCAAG
TCTACCTTGCTTTACTGTTCAATAGAGACAGACTGCTTTAGTATCAATGGTGAGAAACTTTGAGGGGAGAAGTGCACAGA
TTTGATTCAGTTCATAAGCATACACTGAATATTATATCTCCTACTATTCCAAGTGCTGAGCAGAGCGGGGAAGAAAGCCG
TGACAAAGTTGATCANGGAACANCNNGAACTTTANCACTNTCNNGAATTCNCATCNAANNCTANAATAANATCNGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40001973..40002364 361
NO GENE  


Sequence tag IST15038A9HMF1
Sequence
CAGGTAGTTTGCGGGGAAAGAAGCTCAATAAATACACGCCTCAACAGAAGTACCGTAATTAGTGGGTGCCAGCGCTCCTA
GGTGATAAGTCCTTCATTCAGACAGCTGTAGGAATTGGGTATTAAACATTCTAAGTTCTTTGGGGAATTTATCAATCAAG
TCTACCTTGCTTTACTGTTCANTANAGACAGACTGCTTTANTATCAATGGTGANAAACTTTGANGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40002142..40002364 215
NO GENE  


Sequence tag IST15038A9HMR1
Sequence
GCTGGGGACCNAGTCTAGGACCTCATACACACAAGACGACTGCCCTACTGCTAATCCAGCCNGGCCCACACCTCTTACAA
AAAATACTCCTTGGAGATTGATCACTGAGACTTGGGTCAGAGGGAGTTTGCTGTCTTTTAAAGCCGGCCATGATTGACAC
TGGGAAGTTTAATGTGGGTTGTATCTCTTATGGATATCCAGAGTCACATCTTGAACTTGCANACNTTGTGCTGATTTAAA
ATAAGTAAAGTGGGGTTATAAAACACTTGATCACTTTGGCATAACCTTGGATTTTTAAGTTTTCANAANAAAAANCATAT
TANTTC
Sequence Type genomic DNA
Unitrap ID UNI36589

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 30284953..30285277 307
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038732 (Mboat1) NM_153546 membrane bound O-acyltransferase domain containing 1 Gene [Source:MGI (curated);Acc:Mboat1-001]

 
Come back to gene ENSMUSG00000038732


For any suggestions or comments, please send an email to unitrap@crg.es