Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST433085
Clone ID OST433085
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST433085
Sequence
CCCCATGCTATGTGTATGATCTGGCCAAGAACTTCAACCTTGAGGTGTCCCTGTTTGAACGGCTGGTAAAAGTGAACATC
CCCTTTGTCCGTCTGAATTACCAGCACCGCATGCGCCCTGAAATCGCCCGCCTTTTGACCCCCCACATTNACCAGGATCT
GGAGAACCATCCTTCTGTTCTCAAGTATGANCANATTAAGGGTGTCTCCTCCAACCTTTTNTTTGGGGAGCACAACTTTC
CTGAGCAGGANATCCAANAAGGCAAAAGNCACCANAACCAGNATGAGGCNCNCTTTGTGGNGNAGCTGTGCCANTACCTC
NTGTGCCAGNAGTACCNGCCCTCCCAGATCACCATCCT
Sequence Type mRNA
Unitrap ID UNI1729

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 166864506..166865764 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039501 (Znfx1) NM_001033196 zinc finger, NFX1-type containing 1 Gene [Source:MGI (curated);Acc:Znfx1-001]

 
Come back to gene ENSMUSG00000039501


For any suggestions or comments, please send an email to unitrap@crg.es