Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AK0406
Clone ID AK0406
Vector pGT0lxr
Project sanger

Sequence tag AK0406
Sequence
TCACCTGCGACTGATGTCGCTGTCAACCACGGCCAGAGTGTGAAAGCGCAGCCGAGAGTCAGTGGATGAAGCTGAAATGG
AGTATTTGAAGATAGCTCAGGACCTGGAGATGTATGGTGTGAACTACTTTACAATCCGG
Sequence Type mRNA
Unitrap ID UNI3452

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4703681..4704018 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009073 (Nf2) NM_010898 neurofibromatosis 2 Gene [Source:MGI (curated);Acc:Nf2-001]

 
Come back to gene ENSMUSG00000009073


For any suggestions or comments, please send an email to unitrap@crg.es