Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST433040
Clone ID OST433040
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST433040
Sequence
GACTGAGGCAAATCCTGACCCCAACTGTTGTCTTGGCGTGTTTGGGTTGAGCTTATACACCACAGAAAGAGACCTAAGAG
AAGTGTTCTCTAAATATGGCCCCATTGCTGATGTGTCTATTGTATATGACCAGCAATCTAGACGTTCAAGAGGATTTGCC
TTTGTATATTTTGAAAATGTAGACGATGCCAAGGAAGCTAAAGAACGTGCCAATGGAATGGAGCTTGATGGGCGTCGAAT
TAGAGTCGATTTCTCTATAACAAAAAGGCCCCATACCCCAACACCAGGAATTTATATGGGGAGACCCACTTATGGCAGTT
CTCGCCGCCGAGACTATTATGACAGAGGGTACGATCGGGGTTATGATGACCGGGACTATTACAGCAGATCATACAGAGGA
GGAGGTGGTGGAGGAGGTGGATGGAGAGCANCTCAAGACAGGGATCAGATTTACAGAAGACGGGCACCTTNTNCTTACTA
CAGTCGTGGGGGATACAGGTCACGTT
Sequence Type mRNA
Unitrap ID UNI17941

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22247287..22252870 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022858 (Sfrs10) NM_009186 splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:106016]

 
Come back to gene ENSMUSG00000022858


For any suggestions or comments, please send an email to unitrap@crg.es