Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12693F2
Clone ID IST12693F2
Vector VICTR76
Project tigm

Sequence tag IST12693F2BBF1
Sequence
CTACAACAATCGCTAAGCTGTCGGAACTCCCGGCGGGCATCGGTATCCACTCGCACCTTGTTCTTAAGGCTAATTGCTTA
CACTTGCTCCANAGTGCTGGCTGTNGGCCATCAGACACTAAGCAAGGCCCGTGCNCTCACAGAATGATCTTANGATGGCC
TGGANATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35644066..35644232 157
NO GENE  


Sequence tag IST12693F2HMF2
Sequence
CCACCAAATGCGGATAGACCTTCATATGTTTATGCTTGACTTAAACATCTTTTACGTAACAAAAACATCGTTGGGAACTG
TTAGTTGAGCCGTTCACCAAGAACAAACAGAATATTATCGCTGATGGCTGGAAATCTTTTCAAATATGTTGTACAGGTAG
CCCGCATGGTGGATCTGCCGGCCAACAANTGTTA
Sequence Type genomic DNA
Unitrap ID UNI22386

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40216152..40216344 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036822 (Topors) NM_134097 topoisomerase I binding, arginine/serine-rich Gene [Source:MGI (curated);Acc:Topors-001]

 
Come back to gene ENSMUSG00000036822


For any suggestions or comments, please send an email to unitrap@crg.es