Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10115B9
Clone ID IST10115B9
Vector VICTR76
Project tigm

Sequence tag IST10115B9BBF2
Sequence
ACTTGGAGGACAACCATCGCAAGAGTCATTTAATCCCAGCACTCGGGAGGCAAAAGCAGGTGGGTCTCTGAGTTTGAAAA
CAGTCTGGCCGGTGGGGGCGCACGCCTTTAATCCCGGCACTCGGGAGGCAGAGGCAGGCTTTCTGAGTTTGAGGCCGGCC
TGGTCTAAAAGTGAGTTCCAGGACAGCCAGGGCTACACAGAGAAACCCTGAATAAAAAAAAAAAAAAAAAAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10115B9BBR1
Sequence
AGTGATTTCATTTTGCCCACCCTGATGTTCCAGTGCCTTCATAGTACCAGCACAGTGATCAGTAACAGAGGCTAGTGAAC
AGAAGAAGAAGAAACCAAAGTTGCAGGGTAGTTAGGGATGCATGAAATAAGACAGTCACCACTTTTCTCTGAAAACACTC
TGAAAATTAGAAGAGAGCTGAGTTCTCCTTTGCCCCATGTCTTTTCTTATAGGTCATGGACTGGTTCAACACCCAGATCA
CCCATCTCAGGTATGACCCCTAAGAGTCTCCCCCTTTTGTTTCTGACTTAGCACCAAGCAATTCCGGTGTATGTGGGCAC
CAAGGCATTCTTAGAGAAGCAGGGCCCTTTCAGAGGCTTGTTGAAGAGACAGCCTCACATCACTGCTCTTTTTTAACATA
GGCCTCTTCATGTGAGCCTCGGGTGGGATCTCCTCCTAAGAACTCACGGAAAGTGGAGCCTGAGGAAGAGCACGAGGAGG
AGGGGGAGGAGCGGTGCTCAGAAGAGTGGAGGTGGAAGTTCGAGGAGGAGCAGAGGAAAGTTCATCAGCTGGAGCAAGAG
CTCGTGCGAAAGACAGATGAGTGCAAGGCTTCACGCTGCAGCCTC
Sequence Type genomic DNA
Unitrap ID UNI34237

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96486703..96487307 590
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038354 (Ankrd35) NM_001081139 ankyrin repeat domain 35 Gene [Source:MGI (curated);Acc:Ankrd35-001]

 
Come back to gene ENSMUSG00000038354


For any suggestions or comments, please send an email to unitrap@crg.es