Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15096E10
Clone ID IST15096E10
Vector VICTR80
Project tigm

Sequence tag IST15096E10HMF2
Sequence
CTACNTGTCTGGANCCNNAANATCTGGATANAAAAAAGGTGGTGGTGGTGGTGGTGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15096E10BBF1
Sequence
CTACATGTCTGGAGCCNGAAAATCTGGATAGAAAAAAGGTGGTGGTGGTGGTGGTGGGGATTCATGAGCACATATAGATG
TTANAATAAAGGAACAGTCAGAACAAGGCCTATCANATCACTTTAAAAACAAGTCCCAACCAACCCACTACCGTTCTTTC
TGATGCAGAATGCTTTCTCAANATTCTTCTATGGGTGGCCCTGGGAACGACNGACATACNANAAGTACAGACTCNANTTC
ATTTCCCAGGGCGTCNCTGTATANNGCANACACNCACTTGANNAANTGANTTTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15096E10HMR1
Sequence
CGAGAAGCCCAAGCGGCCTGTGTCTGCTATGTTCATCTTCTCTGAGGAGAAGCGAAGGCAGCTACAGGAGGAACGACCTG
AGCTCTCCGAAAGCGAACTGACCCGCCTTCTGGCCCGCATGTGGAACGACTTGTCCGAGAAGAAGAAGGTCGGGCCTTGG
AGAGACCCCCTACTACTCTTCCCTAAGGGTCTCCTGGGCCACTTCCATGCGCGCGGTTACAGCCGCTCCCCGGCACCAGA
AGTGAATCACACGTGTACCGTGTACCCGGGCTCAATTGCTGGGGCGGGAGCCGGAAGAAGGGAAGCTTTCNNCTTCCTTG
TTGGCTCCCTTGGAGAGCGGCCCCATGGGTGGNGCGGAGCTTGNNGGN
Sequence Type genomic DNA
Unitrap ID UNI36590

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102170496..102170858 357
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020923 (Ubtf) NM_001044383 upstream binding transcription factor, RNA polymerase I Gene [Source:MGI (curated);Acc:Ubtf-002]

 
Come back to gene ENSMUSG00000020923


For any suggestions or comments, please send an email to unitrap@crg.es