Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14942C9
Clone ID IST14942C9
Vector VICTR76
Project tigm

Sequence tag IST14942C9HMF2
Sequence
AAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGATTTTCAGACATATG
ATTCTTCTAGTACTATTGACTATCGAATTTTGATCATGAAGGCACATTGGATTTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3114954..3498114 66
NO GENE  


Sequence tag IST14942C9BBF1
Sequence
ACATGATATANACTTTCAGCCTCTCCCTACTTAGCATGTTTGCCTTCAGGTTATCACAACCAAAAAGGTGGGTTCTAACT
TTGTTAAATCCAGCCTTTGCTGAAGGCACATATGCATTCTTGAAGTCCAGTTTCTTTTTAATCTACTTCTCAACTTGTTT
TATGCTGTCCATTAGGCTGTAACTTGCCCTGAGTAGAAAGCCTCTAAGGAGAAAGACACACCCACATTCCTTTCTCTGTT
CTTATAAGCTGGTTCTGTCCTGTATAAACCAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI31980

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 159510503..159510778 272
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028173 (Gpr177) NM_026582 G protein-coupled receptor 177 Gene [Source:MGI Symbol;Acc:MGI:1915401]

 
Come back to gene ENSMUSG00000028173


For any suggestions or comments, please send an email to unitrap@crg.es