Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12663A5
Clone ID IST12663A5
Vector VICTR76
Project tigm

Sequence tag IST12663A5HMF2
Sequence
AAGATAATTTATAGAAGAAAGAGTTTATTGGGGCTCACCGTTCCAGAGGACTAGAGTCATGGCCACTCCCACAAGTTCTG
AGCCACCATTATCCCAGCACATCTTGCAGGCAGAACAGACTACATACTGAAAGTTTTGTAGCTGGGTTGATGTCGCAGAC
TCACTGCTGGGAGCCTTGCCTGGTTATATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 60268660..60268791 130
NO GENE  


Sequence tag IST12663A5BBF1
Sequence
AGATGTACCATCCCCACATCCTCCTTGGCTTCAGAGCCAGTGGGAGTTAGGTACACACAGTTTCAGGCCTGCTTTCCAGC
TCTCTCTGTCTTAGGCCACCTTTCAGGCCAATTGGCAGAAAATTGAATGCCCCAGGGCCCAGGCACCAAGGGGTGAGAAA
GGCAGGACTCTGCTCAGAAGGCAGAGCCTACAGAAGGTACCAAATTTACTGTTGAGTGATTGAGATTGAAAGAGTAGTAA
ACTCAGTGCTCCAAGGTATGCTAATCATAAAACAGATAGTGACATTCCTCCACCCACCCACTTCCTGANTTCAAGGAGTA
TTCNTTCN
Sequence Type genomic DNA
Unitrap ID UNI22780

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 84649510..84649836 323
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027078 (Ube2l6) NM_019949 ubiquitin-conjugating enzyme E2L 6 Gene [Source:MGI (curated);Acc:Ube2l6-001]

 
Come back to gene ENSMUSG00000027078


For any suggestions or comments, please send an email to unitrap@crg.es