Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13217D10
Clone ID IST13217D10
Vector VICTR74
Project tigm

Sequence tag IST13217D10BBF1
Sequence
CAGTCAATGGCTTTCACTGCCTTTAAAATGTGACTCAAAACTCACCTCCTGCAAGGAACATTTCAGGATTGGTTGCACAT
GAATTGTTGCATTTGCTGCTGTGGCCCCCTGGAACTCANCTATTCAAGAGACTATGTAAACGTCCCCTTGTCGCTGGGTT
CTTTTGTTGCAGTGTTCTTCTGGTTTCNAGGCGGCCTTNTNNNANANATTNNNCACATGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13217D10HMR1
Sequence
ACTTCCTGTTGAGGCGTATAGAAATCGCCCTGTATTTGCAAACAAAAGCCCTTGTTGGAGCTTATGGGACTGTTTTAGGT
GTGAAAACTGTCAATTGCTAACCACGGTCTGGGCCCTGCTGTAATTAACTCTGCCAGGGGCTCCTCCCAACTAAGTCTTA
TGTTCCTTCGTGGTTTTGTTTTAGGAATATAACTTGCAAATCTAAATTGGGAAGGGGTAGGACGAAAAATTTCCCACTGA
GCCATAAAGCTGCAGTGCAGGTATCCGTTTCTGGAGGGAGCAGTTATCGAAGTCTCTGGGTTTAAGGCGCTAGGAGGTTT
TACTGTGCTTGATTGACAGTACTGATGGTGTCGGTTAGGATTCANAGGTTGCCCCCTTCNTCCTCTTANTGCTGTACAAA
CANTANNCCTTCCTGTTTGACGGACCTGATACN
Sequence Type genomic DNA
Unitrap ID UNI15377

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44413762..44414193 420
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032097 (Ddx6) NM_007841 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 Gene [Source:MGI Symbol;Acc:MGI:104976]

 
Come back to gene ENSMUSG00000032097


For any suggestions or comments, please send an email to unitrap@crg.es