Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0346
Clone ID AD0346
Vector pGT0lxr
Project sanger

Sequence tag AD0346
Sequence
GTGGTAGTTAGCTCTGATAGATGTTGGTTGTGAGCTCTTCTAGATGGAACACAACAGGTTATTTTTGTACAGGAGATTTC
AGGGGAGGCTTTTTTGTTAGGAGGATGAGGTTCACGTAGAAACAAAATGAGTGGTCCTGCTCAGGTTCCAATGATGTCCC
CAAATGGTTCCGTGCCTCCTATTTATGTGCCTCCTGGATATGCCCCACAG
Sequence Type mRNA
Unitrap ID UNI2961

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 72998873..73083456 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033487 (Fndc3a) NM_207636 fibronectin type III domain containing 3A Gene [Source:MGI Symbol;Acc:MGI:1196463]

 
Come back to gene ENSMUSG00000033487


For any suggestions or comments, please send an email to unitrap@crg.es