Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12681A12
Clone ID IST12681A12
Vector VICTR76
Project tigm

Sequence tag IST12681A12BBF1
Sequence
GTGGTAAGTGTAGCCTCATGTGGGAGGTGATATCTAAGCCACANATCCNTGGATGAGTTATGTTTATAGTGGTAGAAAGC
AGAGGAAGGGAGAACCTGGACACAGGGGTGACCGTGATGTATTTATGCAAGAGAAGCGAGCAGCTTGCCTGTGGAAAGTA
GGTGAACAGATGTGATTTCTAGAGTGAGTGTTAGAATCCTGCTTTGGTCAAGTTGTGGGGGGGGGGN
Sequence Type genomic DNA
Unitrap ID UNI13763

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62634142..62634367 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020067 (Mypn) myopalladin Gene [Source:MGI Symbol;Acc:MGI:1916052]


Sequence tag IST12681A12HMF2
Sequence
CGCCCAGCANANNANNAAACCTNNNTTAAAAAATGAANGNGNACAGGGCCTGAGGCACAATACTTAAGGTTGCCTACGTT
CCTCATACCTGTGTGCACCTGTGCAGTCATGAGCACACGAAGTTGGACTATTCTGAAATGTCTTTTTTTTTAATAAATCT
TTTTTTTAAACATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATTATATGTAAGTACACTGTACCTG
TCTTCAAATACTCCAAAAAAGGGCATCANATTTCATTACNGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAACT
CNGGACCATCGGGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000020067


For any suggestions or comments, please send an email to unitrap@crg.es