Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14550E8
Clone ID IST14550E8
Vector VICTR74
Project tigm

Sequence tag IST14550E8HMF1
Sequence
TTAACATTCATGAGACTACTCCCTTCCAAGGGACAGAAATGCTGAACACTGCAGGGACTAGACAGAGTGCTATTTATCTT
TGTATCCTTGGTGTCTGGCTCACTGCCTGGCACATGGTAGGCACTCAATAAATGACTGGTGAATGAACTGCCTAGTGAAG
GGACAACATGAAAGGAATGGGGGGCATCCAAGGCGAAGAAAGGCATTTGGAAGGAATTTTACATCTCTCTCTACCCTTGA
GTTTCCCTTCACTTCAACCTTGGCTTCTTCATCTACACACACACACACAAACACACACACACCCCTAGCTTTTCCATAAG
ATTCTANAANCCAACCACCCATCTCTANAANCCTCATTTCTTTGTTCTCANCTTCNGAANANNTCTGTCNTCTGCNNGTT
NTGANNNCNTGACAAGCATTCTGTGTGTTGNAANAACACNNNGGTGATTTGANACANTCTTCACTTTTCCCCGTGTTNCN
TNNNGTAGTGATGTGTACCCGGNNNNTGANCNNNTTCACAGTANNNANAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14550E8BBF1
Sequence
TTAACATTCATGAGACTACTCCCTTCCAAGGGACAGAAATGCTGAACACTGCAGGGACTAGACAGAGTGCTATTTATCTT
TGTATCCTTGGTGTCTGGCTCACTGCCTGGCACATGGTAGGCACTCAATAAATGACTGGTGAATGAACTGCCTAGTGAAG
GGACAACATGAAAGGAATGGGGGGCATCCAAGGCGAAGAAAGGCATTTGGAAGGAATTTTACATCTCTCTCTACCCTTGA
GTTTCCCTTCACTTCAACCTTGGCTTCTTCATCTACACACACACACACAAACACACACACNCNCCTAGCTTTTCNANAAN
ATTCTAGAAACNNNCCACCCNTCTCTANAANCCTCANTTCTTTGTTCTCAGCTTCCNAANANNTCTGTCNTCTGCANGTT
TTGANACNNTGACAAGCNNNNTGTGTGNTNNAANAACACANNGGTGATTTNACACNATCTTCACTTTTCCCCGTGNTNCN
NCNNNTNGTGNTGTGNNCCCGGANTNNGANNNTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14550E8HMR1
Sequence
TTAAGTGCAGTTTAATTGATGATATTGTCTTGCTGCTTGGATCCAATTAGGTTGGTCTGGCTTCCTGACTGCTTTACCTC
TTCGAACCTTAGCCCAG
Sequence Type genomic DNA
Unitrap ID UNI370

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29684213..29684309 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069020 (Urm1) NM_026615 ubiquitin related modifier 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Urm1-001]

 
Come back to gene ENSMUSG00000069020


For any suggestions or comments, please send an email to unitrap@crg.es