Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14846A11
Clone ID IST14846A11
Vector VICTR76
Project tigm

Sequence tag IST14846A11HMF1
Sequence
GCTGTACAGCAAAATGTTGTCTTAAAACAAACAAAAAGAGTTGGGTGTGGTGACTCACACCTGTAATCCCAACAGCTGGA
GTCTGAGGCAGGACTGCTGCAAGGGCAGCCTGAACACTTGGCTCAATCTTGTTATCGCTCTCTCTCCAAAACCAATACTG
GAGGCCAGCTTGGTGGCTTAGTTCACAGGGCTTTACAGAGGTGGAGACAGAGGGACCTTAAGTCCTAAAACAAAGCATTT
ACAAAGTATGTGGCCTTGAGAGCCCAGGGCTTGGGTAGGAGCCCAGCTTGCCCACCNNTAGCCACTTATCCAAACCTCAN
CCAGGTGGCTGGCACTGAGGTAACCCTCCNNGGCCN
Sequence Type genomic DNA
Unitrap ID UNI6841

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 96816564..96816918 345
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078700 (D030028A08Rik) RIKEN cDNA D030028A08 gene Gene [Source:MGI Symbol;Acc:MGI:2441931]

 
Come back to gene ENSMUSG00000078700


For any suggestions or comments, please send an email to unitrap@crg.es