Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13602C5
Clone ID IST13602C5
Vector VICTR74
Project tigm

Sequence tag IST13602C5HMR1
Sequence
NNNGNNNNNNTGANTCCCTTGTNANNNNNTGCNNGGNGNNTNCNNNCNNATTGTTGAAACTCCTCATTCGGGGGCCAGGG
TGAGGTGGTCNANTTGGGGATCCCGGGTCGCTAANAACGTCTCTGAAGGGGGCTGTTGGGGGTACTCGGCAGTGTGTGTA
TGGGAAGAGTTGTGTACGTGAGGAAACTCCCGCCAAAAAAAAAATACNAACCCG
Sequence Type genomic DNA
Unitrap ID UNI27020

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28938953..28939116 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063952 (Brpf3) NM_001081315 bromodomain and PHD finger containing, 3 Gene [Source:MGI (curated);Acc:Brpf3-001]

 
Come back to gene ENSMUSG00000063952


For any suggestions or comments, please send an email to unitrap@crg.es