Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12126G12
Clone ID IST12126G12
Vector VICTR76
Project tigm

Sequence tag IST12126G12HMR1
Sequence
NAAGGANNNNCATTGTGTGTGTGGCTGGACTCCATGTTTTAGCCTCTGCATCCTTGACTNANAACAACCTTGACTGANNT
TTNAATANAATTCCTACTANCNAGGANCCTAACTAAGGTTCTAACTTTTTCTGGCCCCCTATTAANGTGGGANACNTCNC
CCANGAATCTAGAGGGGGAACACAGTGAGCCAATCGTTGGGAAGAGGCGGGCCTNGNAATGTANGCTCANAGCTCANCAG
GCACAAAGGCTTTTCAAGAAAGGGCACAAGCACTTTAAAGACAAACTTGAAGCACCTTCTTATTCACAGACAACTAACTC
TGCCCAACTGTGCACGGACAGANCGTGACAAGTGATAAACNNTTTTCTCAAGCACTCTCCCTGATGGAGCAAGGCCAGGA
NATCTGGTCTGCANGATCATCACAACTGACCNGCCCTCCACTGCCGCTTGACCCGCAACTATNGTGCTGCCTCCCTTTCC
GTANTCGCTGGCTGTGTGGGGCCNCTTACTCACGCGCGCACTGTANGCNNNNNCNCACGACGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12126G12HMF1
Sequence
CTTCTGACCTAGGAATTACCAGCAAACAGAACCACGCAGGACAATATATACCTTCCAGTCTCCTCGCGCCTACTTCTCCT
CTCAGACTTGTTA
Sequence Type genomic DNA
Unitrap ID UNI31817

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107454688..107454779 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000010067 (Rassf1) NM_019713 Ras association (RalGDS/AF-6) domain family member 1 Gene [Source:MGI (curated);Acc:Rassf1-002]

 
Come back to gene ENSMUSG00000010067


For any suggestions or comments, please send an email to unitrap@crg.es