Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST432675
Clone ID OST432675
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST432675
Sequence
AGGAAAAAACTATACTGAAGAAGAGGATCAGTTTTCTCATTTGTATGCTGCACAAGCTTGGCTTCGACAAGGAAAATGTG
TATGATGAATGA
Sequence Type mRNA
Unitrap ID UNI17968 UNI17969

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 83228572..83228660 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031715 (Smarca5) NM_053124 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 Gene [Source:MGI (curated);Acc:Smarca5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 146319610..146319698 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000083027 (AL954334.4)  

 
Come back to gene ENSMUSG00000083027


For any suggestions or comments, please send an email to unitrap@crg.es