Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST432549
Clone ID OST432549
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST432549
Sequence
TGGGTTTGCCTGATGAAGCCACTCCACATTATTTTGCCTTAATTGACCAACTAATTGAAGGGCACCAATGGCTGGAAAAA
AATCTAGGAGTGAAACCTCGATCGGGCTGGGCCATAGANCCCTTTGGTCATTCACCCACAATGGCTTATCTTCTAAAGCG
TGCTGGATTTTCACACATGCTCATCCAGAGAGTCCATTATGCAATCAAAAAACACTTCTCTTTGCATAAAACGCTGGAGT
TTTTCTGGAGACAGAATTGGGATCTTGGATCTGCTACAGACATTTTGTGCCATATGATGCCCTTNTACAGCTACGACATC
CCCTCACACCTGTGGGCCTGATCCTAAAATATGCTGNCAGTTNGATTTTAAACGGCATTCCTGGAGGCANATNTGGTTGT
CCCTGGGGAGT
Sequence Type mRNA
Unitrap ID UNI8823

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 65000576..65016224 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024085 (Man2a1) NM_008549 mannosidase 2, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:104669]

 
Come back to gene ENSMUSG00000024085


For any suggestions or comments, please send an email to unitrap@crg.es