Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14558G7
Clone ID IST14558G7
Vector VICTR74
Project tigm

Sequence tag IST14558G7HMF3
Sequence
GAGTCACTGCAAGATCTGTAAACAGCATCCATTTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 71181965..71182001 37
NO GENE  


Sequence tag IST14558G7BBF2
Sequence
NAGTCACTGCAAGATCTGTCGAGGTCGATCGACGGTATCGATTANTCCAATTTANNNTATANNAGTTGTCTGTGTCCTTT
ATCNGGGAATTGAATGATANAGGTGGGGTAAAACTCTGGACTGGGACTAANAATCTCTACTACNCTCANNANNCANTTTA
TTTTGTCTNANTTTNNNANGCTGCANTCCACCCTGACNNCNNANCANCNTGCNCNANGAANAGCATGANANGGTGANNCG
GCAAGCTGCCTTCNGNNNNTTTACCCNANTGTGGCNNGTCCNNCCANNTNNTGAATCTCCTCNANAANGTCCNCACNNAC
ANTCCTGCATCTGGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14558G7HMR1
Sequence
NATTAGAATCTACTTTCCTATCAATAACCTCGAGTTATTACTTAACCCTGTTTCATCTGGGCTGCTTTTAACTCCAGTT
Sequence Type genomic DNA
Unitrap ID UNI26159

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 121500501..121500578 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028127 (Abcd3) NM_008991 ATP-binding cassette, sub-family D (ALD), member 3 Gene [Source:MGI Symbol;Acc:MGI:1349216]

 
Come back to gene ENSMUSG00000028127


For any suggestions or comments, please send an email to unitrap@crg.es