Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14261A10
Clone ID IST14261A10
Vector VICTR74
Project tigm

Sequence tag IST14261A10HMR1
Sequence
CTGGGAGCTCGGGTGGTGGCCGTGCAAAAAAGACAGGGTGGCCTTGGTTGGGTCTGTACAAAGTATCTGGCACCGAGAGT
CAGGCTCCTCCCGGGCGGGAGACTAGGGTCTGACTGCAGTCTAAGATGGGACTTTTGGGTGGGGGAGGGGTCGGCCGGGC
TAAGCCTGGGCGCTGTGCGGTTTAAAGCANCTCTGAGGCCACCGCATCATGCCAGGGACAGGCTGGGCTGGCCANCT
Sequence Type genomic DNA
Unitrap ID UNI31441

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 134777691..134777924 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026443 (Lrrn2) NM_010732 leucine rich repeat protein 2, neuronal Gene [Source:MGI Symbol;Acc:MGI:106037]


Sequence tag IST14261A10HMF1
Sequence
GAAGAGTAAGAAATAGATTCTTTTGGGTAACCTGAGTCCTAGGTATAGTTATAATAAATAGTATATTAGCAAAACGGTTT
GGTATCTCAGTGAATTAGTTTCAGCCTTACATATAGAAAAAGCTGGGGAAAAAAAAGCATCCCTTGACATTGTCTATAGC
GTANNATCCTATATAAATCCAAGCTTCAACAAAAGCTCACTGAGTCTAATAGTTTTCTTTTGAGGTCTCCACGGCCTTAN
TACTCATANATGCAGCCCCTGTTTAAAAGTAAAAAAATTAAAGTANCTTAAAACGGGTTCTTTTTTTTTTTTTTTTTTAA
AAANNNCN
Sequence Type genomic DNA
Unitrap ID UNI36600

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99592103..99592425 309
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032473 (Cldn18) NM_019815 claudin 18 Gene [Source:MGI Symbol;Acc:MGI:1929209]

 
Come back to gene ENSMUSG00000032473


For any suggestions or comments, please send an email to unitrap@crg.es