Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14837D7
Clone ID IST14837D7
Vector VICTR76
Project tigm

Sequence tag IST14837D7HMF1
Sequence
CTGTCCTTCACCAGGGGCTTTTTGCAGCAGGAAGAGCTGAGACCAGCCCAAGCCTGTCCTGTAGAGGCCTGGGCAAAAGA
ACCCTGGTATCAGCTGCATGGTAATCATGCATTTTCCAGGGACCCAAAATAGACACAACCAACCAGGCCCCAGTCCTGTA
CCCAGCACAGGCCCTGCAGGAAATGACTGACTACCCCAACCATCAGAACGCACAGGCACCCTGTGCACTGCCTGCTCATC
CCATACTCATACAGGCTCCTAAAACTATCAGCGGGTGTCCCAAAAAAGACTCTGACCCACCGAAGACAGCAGCCACTAAG
CAGGAAAGGTACTGGCCTTTCACCCTGACAGTAACCTCTGCCCTCTGATTCCTGGCTCTAGGGCAAGGACTCTTACTCNN
AACANAGTGCTTCAGANCANCTGTAATCCCAACACCNAGGAGAATTANAANGTCANGCCNTCCTCAGTGNCNCAGCANTT
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117869538..117870018 451
NO GENE  


Sequence tag IST14837D7HMR1
Sequence
GACAGCAGTCNCACAGGGTTCCCTTGCAGCTTTCTTGCAGAGGTTTAGGAGGCCAGGGTTTGTTTGCTCTGAGGTATTTG
CTGGGAAGCTGGGTGTAGCTTTGTGACCCTCTCAGTGTGGGCAGAGGTAAGGATCAGGGACAGCCTGAGTGGATGGTGAG
ACCCTGGGTTGCTTGTTGCTGCCGTGC
Sequence Type genomic DNA
Unitrap ID UNI23410

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117870014..117870199 184
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017715 (Pgs1) NM_133757 phosphatidylglycerophosphate synthase 1 Gene [Source:MGI (curated);Acc:Pgs1-001]

 
Come back to gene ENSMUSG00000017715


For any suggestions or comments, please send an email to unitrap@crg.es