Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST432449
Clone ID OST432449
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST432449
Sequence
TCCTAGCCCGACCTATGCAAGGACGGTGTGGACCAAGACTGCTGCCTGCCAGGCCGGCGGAGCCGGACATGGAGCCACTG
TGAATCGGCGGCACCGCAGGTGGTGCTGGACTGGTCCAGTTTGTACCTGTCAATAGTTTTAGATAAAGTATTTATCTTTT
TTTTTTTTTAAAG
Sequence Type mRNA
Unitrap ID UNI17986

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80256275..80256443 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061589 (Dot1l) NM_199322 DOT1-like, histone H3 methyltransferase (S. cerevisiae) Gene [Source:MGI (curated);Acc:Dot1l-001]

 
Come back to gene ENSMUSG00000061589


For any suggestions or comments, please send an email to unitrap@crg.es