Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST432404
Clone ID OST432404
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST432404
Sequence
TGAGGCTGAAGGTGAAGACAGCCTGAANAAGATGCAGCTGATGGAGCTTGCAATTCTGAATGGCACCTACAGAGACGCCA
ACATTAAATCACCAGCCCTTGCCTTTTCTCTTGCAGCAACTGCCCAGGCTGCTCCAAGGATCATCACTGGGCCTGCGCCT
GTCCTCCCACCAGCTGCTCTGCGTACACCTACGCCAGCTGGCCCTACCATAATGCCTTTGATCAGACAAATACAGACCGC
TGTCATGCCAAACGGAACTCCTCACCCAACTGCTGCAATAGTCCCTCCAGGGCCTGAAGCTGGGTTAATCTACACACCCT
ATGAATACCCCTACACATTGGCACCAGCTACATCAATCCTTGAGTACCCTATTGAACCCAGTGGTGTGTTAGGNGCGGTG
GCTACTAAAGTTCGAAGGCACNATATGCGTGTCCATCCTTACCAAAGGATTGTGACCGCAGACCGAGCCGNCACCGGCAA
CTAACCTATGG
Sequence Type mRNA
Unitrap ID UNI4770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 10402474..10410670 301
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062078 (Qk) NM_021881 quaking Gene [Source:MGI Symbol;Acc:MGI:97837]

 
Come back to gene ENSMUSG00000062078


For any suggestions or comments, please send an email to unitrap@crg.es