Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13612E9
Clone ID IST13612E9
Vector VICTR74
Project tigm

Sequence tag IST13612E9HMF1
Sequence
CTCTTCTGAAGGTCCTGANTTCAAATCCCANCAACCNCATGGTANCTCACAACTATCTGTAATGANATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13612E9HMR1
Sequence
GGTTGGCCTTGAACTCTTTTTTAAAGATATTTTATTTATTTTATGTATATGAGTACACACTGTAGCTGTTCAGTTGGTTG
TGAGCCTTCATGTGGTTGTTGGGATCTGAATTTAGGACCTCTGCTCGCTCCAGTCAATCCTGCTCGCTCAGGTCCGCCCC
ACTCAATCAGTCCCTGTTCGCTCCAGCTCAAAGATTTATTCTTTACATAAATAAGAACACTGTAGCTATGGCGTCAGATC
TCATTGCGGGTGGTTGTGAGCCACCATGTGATGAACTCAGAACCTTTGGAAAAGCAGTCAGTGCGTTTACCTGCTGANCC
NTCTCACCAGTCCCTGGCCTTGAACTCTTGATCCTTTTGTCNGAGTCACTGGANTGAGTGGAATTTCTTANAANNNTCTG
TTTTANAACNNTN
Sequence Type genomic DNA
Unitrap ID UNI29695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34935786..34936194 391
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es